Skip to content

01_Data_Preparation.md

Latest commit

 

History

History
50 lines (40 loc) · 3.55 KB

01_Data_Preparation.md

File metadata and controls

50 lines (40 loc) · 3.55 KB

Data Preparation for your own BAM/SAM file to run MethylBERT

Input requirements

In order to run MethylBERT, these files are required:

  1. Input bulk sample as a BAM/SAM file
  2. Reference genome as a FASTA file
  3. DMRs as a tab-separated .csv file
  4. (Optional, in case you want to fine-tune the MethylBERT model with your data) Pure tumour and normal samples as BAM/SAM files

1. BAM/SAM File format

MethylBERT currently supports only bismark-aligned samples where read-level methylation calls are given with XM tag. XM tage stores methylation calls as follows:

  • x : Unmethylated cytosine at CHH
  • X : Methylated cytosine at CHH
  • h : Unmethylated cytosine at CHG context
  • H : Methylated cytosine at CHG context
  • z : Unmethylated cytosine at CpG context
  • Z : Methylated cytosine at CpG context

Each sequence read has its methylation call with XM tag like:

SRR5390326.sra.2060072_2060072_length=150       16      chr1    3000485 42      118M    *       0       0 
AATTTCAACTCTAAATTTAATTATTTCCTACTATCTACTCATCTTAAATAAATTTACTTCCTTTTATTCTAAAACTTCTAAATTTACTATCAAACTACTAATATATACTCTAATTTCC  
JA-FFJJJFJJJJJJJJJJJJJJFJJJJJJJJJFJJJJFJJFJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJFJJFJFJFJJJFJJJJJJJFJJAJJ<JJFFJAAJJJJFF<JJJJ  
MD:Z:0G6G4G1G3G10G2G12G0G0G1G5G9G5G1G6G4G2G3G0G2G3G1G9G5        XG:Z:GA NM:i:24 
XM:Z:h......x....x.h...h..........x..x............hhh.h.....h.........h.....h.h......h....h..x...xh..x...h.h.........h.....
XR:Z:CT PG:Z:MarkDuplicates-6C1DF036

If you have any suggestions for a read aligner/mapper or methylation caller to be supported by MethylBERT, please leave it in the issue tab.

2. Reference file

MethylBERT uses a reference genome to acquire consistent DNA sequences (disregarding SNVs, mutations etc.) for the given sequence reads. The reference genome FASTA file used for aligning the BAM/SAM files should be provided. You can download various reference genomes on the UCSC web-site.

3. DMRs

MethylBERT uses only reads overlapping with given differentially methylated regions (DMRs). The DMRs must be given as a tab-separated .csv style file including three columns (chr, start, end):

chr     start   end     length  nCG     meanMethy1      meanMethy2      diff.Methy      areaStat        ctype
chr2    107469896       107470095       200     5       0.0376047481667001      0.925271144570319       -0.887666396403618      -97.6899490136342       mPv
chr19   46474351        46474642        292     13      0.0905692796563347      0.945569253529007       -0.854999973872673      -187.403587988962       mPv
chr4    107989023       107989302       280     8       0.05951346726543        0.908318149867157       -0.848804682601727      -162.881526978275       mL6-2
chr17   65373109        65373244        136     5       0.0858110427730819      0.918285474669721       -0.832474431896639      -85.6599363826153       mL6-2
chr2    83028176        83028389        214     5       0.117763559475859       0.944228847738697       -0.826465288262838      -51.3069729996581       mPv

We used DSS R package to call DMRs from pure tumour and normal methylomes.

Simulated read-level methylomes

If you want to test MethylBERT or practice the usage of MethylBERT, the simulated read-level methylomes from our methylseq_simulation tool can be used.